|
Vector Biolabs
rictor shrna Rictor Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rictor shrna/product/Vector Biolabs Average 90 stars, based on 1 article reviews
rictor shrna - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rictor sirna ![]() Rictor Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rictor sirna/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rictor sirna - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
sirna against rictor ![]() Sirna Against Rictor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna against rictor/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
sirna against rictor - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rictor shrna ![]() Rictor Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rictor shrna/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rictor shrna - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
tacttgtgaagaatcgtatctt human rictor 2 addgene ![]() Tacttgtgaagaatcgtatctt Human Rictor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tacttgtgaagaatcgtatctt human rictor 2 addgene/product/Addgene inc Average 93 stars, based on 1 article reviews
tacttgtgaagaatcgtatctt human rictor 2 addgene - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rictor shrna plasmid ![]() Rictor Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rictor shrna plasmid/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rictor shrna plasmid - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
lentivirus expressing rictor 2 shrna ![]() Lentivirus Expressing Rictor 2 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentivirus expressing rictor 2 shrna/product/Addgene inc Average 93 stars, based on 1 article reviews
lentivirus expressing rictor 2 shrna - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti sirt1 ![]() Anti Sirt1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti sirt1/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
anti sirt1 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
shrna1 rictor ![]() Shrna1 Rictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna1 rictor/product/Addgene inc Average 90 stars, based on 1 article reviews
shrna1 rictor - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OriGene
pooled sirna duplexes ![]() Pooled Sirna Duplexes, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pooled sirna duplexes/product/OriGene Average 90 stars, based on 1 article reviews
pooled sirna duplexes - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
rictor short hairpin rnas shrnas ![]() Rictor Short Hairpin Rnas Shrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rictor short hairpin rnas shrnas/product/Addgene inc Average 86 stars, based on 1 article reviews
rictor short hairpin rnas shrnas - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
lentiviral particles ![]() Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral particles/product/Santa Cruz Biotechnology Average 86 stars, based on 1 article reviews
lentiviral particles - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific Reports
Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration
doi: 10.1038/s41598-025-93320-x
Figure Lengend Snippet: Regulatory effects of PPARγ on mTORC2 activation and proliferation in VSMCs. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) Expression of PPARγ, p-mTORC2 (Ser2481), p-Akt (Ser473), and p-Akt (Thr308) was investigated via western blot analysis. ( B ) VSMCs were stained with anti-PPARγ antibody (green) and p-mTORC2 (Ser2481; red), and nuclei were stained with DAPI (blue). Cells were observed under a confocal microscope. ( C , D ) Cell proliferation was confirmed using MTT assay and cell counting. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.
Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or
Techniques: Activation Assay, Transfection, Control, Expressing, Western Blot, Staining, Microscopy, MTT Assay, Cell Counting
Journal: Scientific Reports
Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration
doi: 10.1038/s41598-025-93320-x
Figure Lengend Snippet: Inhibitory effects of pioglitazone-induced PPARγ on VSMC phenotype switching, migration, and atherosclerosis. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were confirmed by western blot analysis. ( B ) Cell migration was investigated using wound healing assay. ( C ) ADRP expression was examined using western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.
Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or
Techniques: Migration, Transfection, Control, Western Blot, Wound Healing Assay, Expressing, Staining
Journal: Scientific Reports
Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration
doi: 10.1038/s41598-025-93320-x
Figure Lengend Snippet: Anti-proliferative effect of pioglitazone via PPARγ-mTORC2 signaling pathway in VSMCs. VSMCs were transfected with control siRNA or Rictor siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) The expression of Rictor, PPARγ, p-mTORC2 (Ser2481), and p-Akt (Ser473) was investigated by western blot analysis. ( B ) Cell proliferation was examined using cell counting. ( C ) Expression of ADRP, a lipid droplet marker, was confirmed via western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). ( E ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were investigated by western blot analysis. ( F ) Cell migration was investigated using wound healing assay. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.
Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or
Techniques: Transfection, Control, Expressing, Western Blot, Cell Counting, Marker, Staining, Migration, Wound Healing Assay
Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology
Article Title: The mTOR Kinase Inhibitor CZ415 Inhibits Human Papillary Thyroid Carcinoma Cell Growth.
doi: 10.1159/000488625
Figure Lengend Snippet: Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the mTOR-Rictor-GβL association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor shRNA (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Article Snippet: Protein G Sepharose (30 μL per treatment, Sigma) was then added again to the lysates. mTOR complexes were then washed and subjected to Western blotting assay. shRNA The lentiviral particles with Beclin-1 shRNA (sc-29797-V),
Techniques: Activation Assay, Cell Culture, Co-Immunoprecipitation Assay, Expressing, Infection, shRNA, CCK-8 Assay, Standard Deviation
Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology
Article Title: The mTOR Kinase Inhibitor CZ415 Inhibits Human Papillary Thyroid Carcinoma Cell Growth.
doi: 10.1159/000488625
Figure Lengend Snippet: Fig. 5. Autophagy inhibition sensitizes CZ415-induced cytotoxicity in PTC cells. TPC-1 cells with Beclin shRNA (“shBeclin-1”) or scramble control shRNA (“shC”) were treated with/out CZ415 (100 and 1000 nM), cells were cultured in the conditional medium for applied time; Beclin-1 expression was tested by Western blotting assay (A, the upper panel); Cell survival and apoptosis were tested by CCK-8 assay (A, the lower panel) and Hoechst-33342 staining assay (B), respectively. Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “shC” group. The experiments were repeated three times, and similar results were obtained.
Article Snippet: Protein G Sepharose (30 μL per treatment, Sigma) was then added again to the lysates. mTOR complexes were then washed and subjected to Western blotting assay. shRNA The lentiviral particles with Beclin-1 shRNA (sc-29797-V),
Techniques: Inhibition, shRNA, Control, Cell Culture, Expressing, Western Blot, CCK-8 Assay, Staining, Standard Deviation