rictor shrna Search Results


90
Vector Biolabs rictor shrna
Rictor Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rictor shrna/product/Vector Biolabs
Average 90 stars, based on 1 article reviews
rictor shrna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rictor sirna
Regulatory effects of PPARγ on mTORC2 activation and proliferation in VSMCs. VSMCs were transfected with control <t>siRNA</t> or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) Expression of PPARγ, p-mTORC2 (Ser2481), p-Akt (Ser473), and p-Akt (Thr308) was investigated via western blot analysis. ( B ) VSMCs were stained with anti-PPARγ antibody (green) and p-mTORC2 (Ser2481; red), and nuclei were stained with DAPI (blue). Cells were observed under a confocal microscope. ( C , D ) Cell proliferation was confirmed using MTT assay and cell counting. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.
Rictor Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rictor sirna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rictor sirna - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Cell Signaling Technology Inc sirna against rictor
Regulatory effects of PPARγ on mTORC2 activation and proliferation in VSMCs. VSMCs were transfected with control <t>siRNA</t> or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) Expression of PPARγ, p-mTORC2 (Ser2481), p-Akt (Ser473), and p-Akt (Thr308) was investigated via western blot analysis. ( B ) VSMCs were stained with anti-PPARγ antibody (green) and p-mTORC2 (Ser2481; red), and nuclei were stained with DAPI (blue). Cells were observed under a confocal microscope. ( C , D ) Cell proliferation was confirmed using MTT assay and cell counting. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.
Sirna Against Rictor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna against rictor/product/Cell Signaling Technology Inc
Average 90 stars, based on 1 article reviews
sirna against rictor - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rictor shrna
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Rictor Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rictor shrna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rictor shrna - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc tacttgtgaagaatcgtatctt human rictor 2 addgene
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Tacttgtgaagaatcgtatctt Human Rictor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tacttgtgaagaatcgtatctt human rictor 2 addgene/product/Addgene inc
Average 93 stars, based on 1 article reviews
tacttgtgaagaatcgtatctt human rictor 2 addgene - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rictor shrna plasmid
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Rictor Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rictor shrna plasmid/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rictor shrna plasmid - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc lentivirus expressing rictor 2 shrna
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Lentivirus Expressing Rictor 2 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus expressing rictor 2 shrna/product/Addgene inc
Average 93 stars, based on 1 article reviews
lentivirus expressing rictor 2 shrna - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc anti sirt1
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Anti Sirt1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti sirt1/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
anti sirt1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc shrna1 rictor
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Shrna1 Rictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna1 rictor/product/Addgene inc
Average 90 stars, based on 1 article reviews
shrna1 rictor - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
OriGene pooled sirna duplexes
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Pooled Sirna Duplexes, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pooled sirna duplexes/product/OriGene
Average 90 stars, based on 1 article reviews
pooled sirna duplexes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

86
Addgene inc rictor short hairpin rnas shrnas
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Rictor Short Hairpin Rnas Shrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rictor short hairpin rnas shrnas/product/Addgene inc
Average 86 stars, based on 1 article reviews
rictor short hairpin rnas shrnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Santa Cruz Biotechnology lentiviral particles
Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the <t>mTOR-Rictor-GβL</t> association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor <t>shRNA</t> (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.
Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral particles/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews
lentiviral particles - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


Regulatory effects of PPARγ on mTORC2 activation and proliferation in VSMCs. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) Expression of PPARγ, p-mTORC2 (Ser2481), p-Akt (Ser473), and p-Akt (Thr308) was investigated via western blot analysis. ( B ) VSMCs were stained with anti-PPARγ antibody (green) and p-mTORC2 (Ser2481; red), and nuclei were stained with DAPI (blue). Cells were observed under a confocal microscope. ( C , D ) Cell proliferation was confirmed using MTT assay and cell counting. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Journal: Scientific Reports

Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration

doi: 10.1038/s41598-025-93320-x

Figure Lengend Snippet: Regulatory effects of PPARγ on mTORC2 activation and proliferation in VSMCs. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) Expression of PPARγ, p-mTORC2 (Ser2481), p-Akt (Ser473), and p-Akt (Thr308) was investigated via western blot analysis. ( B ) VSMCs were stained with anti-PPARγ antibody (green) and p-mTORC2 (Ser2481; red), and nuclei were stained with DAPI (blue). Cells were observed under a confocal microscope. ( C , D ) Cell proliferation was confirmed using MTT assay and cell counting. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or Rictor siRNA (Santa Cruz) for 6 h in Opti-MEM reduced serum medium (Thermo Fisher Scientific).

Techniques: Activation Assay, Transfection, Control, Expressing, Western Blot, Staining, Microscopy, MTT Assay, Cell Counting

Inhibitory effects of pioglitazone-induced PPARγ on VSMC phenotype switching, migration, and atherosclerosis. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were confirmed by western blot analysis. ( B ) Cell migration was investigated using wound healing assay. ( C ) ADRP expression was examined using western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Journal: Scientific Reports

Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration

doi: 10.1038/s41598-025-93320-x

Figure Lengend Snippet: Inhibitory effects of pioglitazone-induced PPARγ on VSMC phenotype switching, migration, and atherosclerosis. VSMCs were transfected with control siRNA or PPARγ siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were confirmed by western blot analysis. ( B ) Cell migration was investigated using wound healing assay. ( C ) ADRP expression was examined using western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or Rictor siRNA (Santa Cruz) for 6 h in Opti-MEM reduced serum medium (Thermo Fisher Scientific).

Techniques: Migration, Transfection, Control, Western Blot, Wound Healing Assay, Expressing, Staining

Anti-proliferative effect of pioglitazone via PPARγ-mTORC2 signaling pathway in VSMCs. VSMCs were transfected with control siRNA or Rictor siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) The expression of Rictor, PPARγ, p-mTORC2 (Ser2481), and p-Akt (Ser473) was investigated by western blot analysis. ( B ) Cell proliferation was examined using cell counting. ( C ) Expression of ADRP, a lipid droplet marker, was confirmed via western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). ( E ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were investigated by western blot analysis. ( F ) Cell migration was investigated using wound healing assay. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Journal: Scientific Reports

Article Title: Differential expression of PPARγ by pioglitazone and telmisartan causes effect of disparity on mTORC2-mediated cell proliferation and migration

doi: 10.1038/s41598-025-93320-x

Figure Lengend Snippet: Anti-proliferative effect of pioglitazone via PPARγ-mTORC2 signaling pathway in VSMCs. VSMCs were transfected with control siRNA or Rictor siRNA. Cells were pretreated with pioglitazone (100 μM) for 30 min and then treated with PDGF-BB (10 ng/ml) for 48 h. ( A ) The expression of Rictor, PPARγ, p-mTORC2 (Ser2481), and p-Akt (Ser473) was investigated by western blot analysis. ( B ) Cell proliferation was examined using cell counting. ( C ) Expression of ADRP, a lipid droplet marker, was confirmed via western blot analysis. ( D ) Cells were stained with BODIPY (a lipid staining dye; green), and nuclei were stained with DAPI (blue). ( E ) VSMC synthetic markers (collagen I and fibronectin) and contractile markers (α-SMA, calponin, and SM22α) were investigated by western blot analysis. ( F ) Cell migration was investigated using wound healing assay. Scale bar = 50 μm. The results are representative of three independent experiments. * p < 0.05.

Article Snippet: VSMCs were transfected with 10 μM control siRNA, PPARγ siRNA, or Rictor siRNA (Santa Cruz) for 6 h in Opti-MEM reduced serum medium (Thermo Fisher Scientific).

Techniques: Transfection, Control, Expressing, Western Blot, Cell Counting, Marker, Staining, Migration, Wound Healing Assay

Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the mTOR-Rictor-GβL association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor shRNA (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.

Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology

Article Title: The mTOR Kinase Inhibitor CZ415 Inhibits Human Papillary Thyroid Carcinoma Cell Growth.

doi: 10.1159/000488625

Figure Lengend Snippet: Fig. 4. CZ415 blocks mTORC1 and mTORC2 activation in PTC cells. TPC-1 cells (A, B, G and H), the primary PTC cells (“Line1”, C) or the primary human thyroid epithelial cells (“Epi-1”, D) were treated with CZ415 (1000 nM) or PP242 (1000 nM), cells were cultured for 2 hours; the mTOR-Raptor association and the mTOR-Rictor-GβL association were tested by co-immunoprecipitation (“Co-IP”) assay (A and G, left panel); Expression of the listed proteins were shown [A and G, right panel (“INPUT”), B-D and H]; TPC-1 cells (E and I) or the primary PTC cells (“Line1”, F and J) were treated with CZ415 (1000 nM), P242 (1000 nM), MK-2206 (1000 nM), RAD001 (1000 nM), or infected with Rictor shRNA (“shRictor”) lentivirus; Cells were further cultured for 72 hours, and cell viability was tested by CCK-8 assay (E, F, I and J). Rictor expression was also shown (E and F, the upper panel). Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “CZ415” only group. The experiments were repeated three times, and similar results were obtained.

Article Snippet: Protein G Sepharose (30 μL per treatment, Sigma) was then added again to the lysates. mTOR complexes were then washed and subjected to Western blotting assay. shRNA The lentiviral particles with Beclin-1 shRNA (sc-29797-V), Rictor shRNA (sc-61478-V) as well as the scramble control shRNA were purchased from Santa Cruz Biotech (Shanghai, China).

Techniques: Activation Assay, Cell Culture, Co-Immunoprecipitation Assay, Expressing, Infection, shRNA, CCK-8 Assay, Standard Deviation

Fig. 5. Autophagy inhibition sensitizes CZ415-induced cytotoxicity in PTC cells. TPC-1 cells with Beclin shRNA (“shBeclin-1”) or scramble control shRNA (“shC”) were treated with/out CZ415 (100 and 1000 nM), cells were cultured in the conditional medium for applied time; Beclin-1 expression was tested by Western blotting assay (A, the upper panel); Cell survival and apoptosis were tested by CCK-8 assay (A, the lower panel) and Hoechst-33342 staining assay (B), respectively. Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “shC” group. The experiments were repeated three times, and similar results were obtained.

Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology

Article Title: The mTOR Kinase Inhibitor CZ415 Inhibits Human Papillary Thyroid Carcinoma Cell Growth.

doi: 10.1159/000488625

Figure Lengend Snippet: Fig. 5. Autophagy inhibition sensitizes CZ415-induced cytotoxicity in PTC cells. TPC-1 cells with Beclin shRNA (“shBeclin-1”) or scramble control shRNA (“shC”) were treated with/out CZ415 (100 and 1000 nM), cells were cultured in the conditional medium for applied time; Beclin-1 expression was tested by Western blotting assay (A, the upper panel); Cell survival and apoptosis were tested by CCK-8 assay (A, the lower panel) and Hoechst-33342 staining assay (B), respectively. Data were presented as mean ± standard deviation (SD, n=5). *p<0.05 vs. “C” group. # p<0.05 vs. “shC” group. The experiments were repeated three times, and similar results were obtained.

Article Snippet: Protein G Sepharose (30 μL per treatment, Sigma) was then added again to the lysates. mTOR complexes were then washed and subjected to Western blotting assay. shRNA The lentiviral particles with Beclin-1 shRNA (sc-29797-V), Rictor shRNA (sc-61478-V) as well as the scramble control shRNA were purchased from Santa Cruz Biotech (Shanghai, China).

Techniques: Inhibition, shRNA, Control, Cell Culture, Expressing, Western Blot, CCK-8 Assay, Staining, Standard Deviation